View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18296_low_9 (Length: 410)
Name: NF18296_low_9
Description: NF18296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18296_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 9e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 12395047 - 12394785
Alignment:
| Q |
19 |
ggtaaaactgtaatcacattcctcacgaactactccaatcatcccgattctcaaatttctaacgtgtgcaaatatttgaatttcattttatctggtccga |
118 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
12395047 |
ggtaaagctgtaatcacattcctcatgaactactccaatcatcccgattctcaaatttctaatgtgtgcaaatatttgaattccattttatctggtccaa |
12394948 |
T |
 |
| Q |
119 |
gttatgactaactcctctgtttggtgttatagaaaaggttgtgattttgccgatgcctgcaaagttgttttat----ctcaccctcaagtattttaggca |
214 |
Q |
| |
|
|||| ||||| || ||||||||||||||| | |||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12394947 |
attattactaaatcgtctgtttggtgttatcaagaaggttgtgattttgctgatgcctgcaaagttgttttatcaccctcaccctc-agtattttaggca |
12394849 |
T |
 |
| Q |
215 |
gttggttttag-tttgtgaacctctctaggtggaaggttt-taattttcagaattggattatgt |
276 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| |||| | |||||||| ||||||||||| |
|
|
| T |
12394848 |
gttggttttagttttgtgaacctctctaggtagaaagtttgtgattttcagctttggattatgt |
12394785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University