View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18297_high_14 (Length: 271)
Name: NF18297_high_14
Description: NF18297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18297_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 134 - 265
Target Start/End: Complemental strand, 54947049 - 54946907
Alignment:
| Q |
134 |
agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtccttttttattgctaacaaacgc-----------ataatgttttgcaattt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
54947049 |
agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtctttttttattcctaacaaacgcacgttactgtaataatgttttgtgattt |
54946950 |
T |
 |
| Q |
223 |
cattggtgtcgtgcttctcttctatatgttttcatgtttaaaa |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54946949 |
cattggtgtcgtgcttctcttctatatgttttcatgtttaaaa |
54946907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 54947153 - 54947103
Alignment:
| Q |
30 |
caataataaacaaactataaatcacttttatgataaaattatcacttttgt |
80 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54947153 |
caataataaacaaactataaatcactattatgataaaattatcacttttgt |
54947103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University