View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18297_high_16 (Length: 262)
Name: NF18297_high_16
Description: NF18297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18297_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 246
Target Start/End: Complemental strand, 42033893 - 42033663
Alignment:
| Q |
16 |
atgcaagttcatcactcaatccaccaccaatagttctcgccgcgctagcttcattagcattaacaacccttccctcaaggttaatccacgccattggctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033893 |
atgcaagttcatcactcaatccaccaccaatagttctcgccgcgctagcttcattagcattaacaacccttccctcaaggttaatccacgccattggctt |
42033794 |
T |
 |
| Q |
116 |
cgaaaatgagatcggacatcgcggctggacggttgtggcggagagacggtgccggcgggagagagtgattggaggaattgaaacgagacatggtaacggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033793 |
cgaaaatgagatcggacatcgcggctcgacggttgtggcggagagacggtgccggcgggagagagtgattggaggaattgaaacgagacatggtaacggt |
42033694 |
T |
 |
| Q |
216 |
gaagtagcgttagggttgccgttagagttgt |
246 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |
|
|
| T |
42033693 |
gaagtagagttagggttgccgttagagttgt |
42033663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University