View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18297_high_21 (Length: 213)
Name: NF18297_high_21
Description: NF18297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18297_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 12 - 130
Target Start/End: Complemental strand, 26184777 - 26184659
Alignment:
| Q |
12 |
aacctgtgtttggattccacataatgtaggacatattggatatcatagtaaccgtgactgacacaatcttttactgcaactcacgtgcaagacagaatgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26184777 |
aacctgtgtttggattccacataatgtaggacatattggatatcatagtaaccgtgactgacacaatcttttactgcaactcacgtgcaagacagaatgg |
26184678 |
T |
 |
| Q |
112 |
accaccacttccccacgtg |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26184677 |
accaccacttccccacgtg |
26184659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 128 - 196
Target Start/End: Complemental strand, 26184614 - 26184546
Alignment:
| Q |
128 |
gtgcataactgatcttcacaaacacaatggaacagatattctatttaggttcgtttttgggtacacttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26184614 |
gtgcataactgatcttcacaaacacaatggaacagatattctatttaggttcgtttttgggtacacttt |
26184546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University