View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18297_low_15 (Length: 279)
Name: NF18297_low_15
Description: NF18297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18297_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 160 - 258
Target Start/End: Complemental strand, 40948487 - 40948389
Alignment:
| Q |
160 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40948487 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagta |
40948389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 27 - 144
Target Start/End: Complemental strand, 40945611 - 40945494
Alignment:
| Q |
27 |
aaatcacttatcgttgtttggctaacacctgaacaaatggctcaaagacaagatactgagctgaaacatattgtttttgggatagctgcttcatcggatt |
126 |
Q |
| |
|
||||||| ||| |||||| || ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
40945611 |
aaatcacctattgttgttcggttaacaccggaacaaatggctcaaagacaagatactgagctgaaacacattgtttttgggatagctgcttcatcaaatt |
40945512 |
T |
|
| Q |
127 |
tatggaatacaagaaaag |
144 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40945511 |
tatggaatacaagaaaag |
40945494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 67 - 142
Target Start/End: Complemental strand, 22776957 - 22776882
Alignment:
| Q |
67 |
ctcaaagacaagatactgagctgaaacatattgtttttgggatagctgcttcatcggatttatggaatacaagaaa |
142 |
Q |
| |
|
||||||||||||| || ||| | ||||| ||||||||||||||||| |||||||| |||| ||||| | |||||| |
|
|
| T |
22776957 |
ctcaaagacaagacacagagatcaaacacattgtttttgggatagcggcttcatcaaatttgtggaacataagaaa |
22776882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University