View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18297_low_16 (Length: 271)

Name: NF18297_low_16
Description: NF18297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18297_low_16
NF18297_low_16
[»] chr4 (2 HSPs)
chr4 (134-265)||(54946907-54947049)
chr4 (30-80)||(54947103-54947153)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 134 - 265
Target Start/End: Complemental strand, 54947049 - 54946907
Alignment:
134 agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtccttttttattgctaacaaacgc-----------ataatgttttgcaattt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||           |||||||||||  ||||    
54947049 agaatctaattttttatacaatttataaattataaaatgtcaaaatcgtctttttttattcctaacaaacgcacgttactgtaataatgttttgtgattt 54946950  T
223 cattggtgtcgtgcttctcttctatatgttttcatgtttaaaa 265  Q
    |||||||||||||||||||||||||||||||||||||||||||    
54946949 cattggtgtcgtgcttctcttctatatgttttcatgtttaaaa 54946907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 54947153 - 54947103
Alignment:
30 caataataaacaaactataaatcacttttatgataaaattatcacttttgt 80  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||    
54947153 caataataaacaaactataaatcactattatgataaaattatcacttttgt 54947103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University