View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18297_low_19 (Length: 255)
Name: NF18297_low_19
Description: NF18297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18297_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 14664763 - 14664546
Alignment:
| Q |
19 |
caagtcactttgataaacacagagcagatagatgaggatagttgcatgttgcatcatgtacagatcagaaagagaaccaacaaatatcggaattgtgaga |
118 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14664763 |
caagtcactttgataaacatag--cagatagatgaggatagttgcatgttgcatcatgtacagatcagaaagagaaccaacaaatatcggaattgtgaga |
14664666 |
T |
|
| Q |
119 |
aaaaagagaaatcactcggtccctctcctttccaaattccaaggatcttagttgtttggtttgatacttggccaaacttcgttactagacgtctttagtc |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14664665 |
aaaaagagaaatcactcagtccctctcctttccaaattccaaggatcttagttgtttggtttgatacttggccaaacttcgttactagacgtctttagtc |
14664566 |
T |
|
| Q |
219 |
tattgtttgcgattattatt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14664565 |
tattgtttgcgattattatt |
14664546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 30735707 - 30735748
Alignment:
| Q |
21 |
agtcactttgataaacacagagcagatagatgaggatagttg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30735707 |
agtcactttgataaacacagagcagatagatgaggatagttg |
30735748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University