View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18298_low_7 (Length: 203)
Name: NF18298_low_7
Description: NF18298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18298_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 29235355 - 29235184
Alignment:
| Q |
18 |
atctttaccatgatgtt-agcaacaatggaagaaggattaaggtgaattgaacttctagttttggtttctgaaagcacgttgtttgaaaatgctaaggat |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29235355 |
atctttaccatgatgtttagcaacaatggaagaaggattaaggtgaattgaacttctagctttggtttctgaaagcacgttgtttgaaaatgctaaggat |
29235256 |
T |
 |
| Q |
117 |
ttaagtctcttgcgttctatggtttctgggtttgttgcgtcagcttcttcgtcgctgcgtgttttcttcttc |
188 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29235255 |
ttgagtctcttgcgttctatggtttctgggtttgttgcgtcggcttcttcgtcgctgcgtgttttcttcttc |
29235184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University