View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18299_high_4 (Length: 397)
Name: NF18299_high_4
Description: NF18299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18299_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 19 - 390
Target Start/End: Complemental strand, 3826534 - 3826160
Alignment:
| Q |
19 |
ggtatgtagtaaggggagataggtttattcagtcacatgcatgcatattttgtaaatttacttttccttttatatctatttttactaatgggtgtgaacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3826534 |
ggtatgtagtaaggggagataggtttattcagtcacatgcatgcatattttgtaaatttacttttccttttatatctatttttactaatgggtgtgcacc |
3826435 |
T |
 |
| Q |
119 |
tacatacaaaagatttatggttatgtccaaccaagcctaactcgcattaaggtagggtagacaagttgattattatttttctgattggtatataaactcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3826434 |
tacatacaaaagatttatggttatgtccaaccaagcctaactcgcattaaggtagggtagacaagttgattattatttttctgattggtatataaactcg |
3826335 |
T |
 |
| Q |
219 |
atagtgcgtttgagccgattggcttcaaaaatgataagctcattctttgtatatgggttatgggatcctttaagcttatttagctaaagggt----ttag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
3826334 |
atagtgcgtttgagccgattggcttcaaaatagataagctcattctttgtatatgggttatgggatcctttaagc-tatttagctaaagggtttaattag |
3826236 |
T |
 |
| Q |
315 |
ttacgctctaaatcaagggtgtcttcaacctctaacatgcaatagttctatttgatattgcgcagggttgtctctg |
390 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3826235 |
ttacgctctaaattaagggtgtcttcaacctctaacatgcaatagttctatttgatattgcgcagggttgtctctg |
3826160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University