View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18299_high_7 (Length: 271)
Name: NF18299_high_7
Description: NF18299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18299_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 40441054 - 40441278
Alignment:
| Q |
18 |
caaattactaacctgtgtgagttttgggaatgcatgacaagaaatcattacaagtcttccttgatagtggtagcacccacaacttcttggacttggagac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40441054 |
caaattactaacctgtgtgagttttgggaatgcatgacaagaaatcattacaagtcttccttgatagtggtagcacccacaacttcttggacttggagac |
40441153 |
T |
 |
| Q |
118 |
aactaagaaactatgttttaagttagaggttattactcctatgtaggttaccggaggggtagggtgtagtcaattaaatgctccctacatgtgtagtggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40441154 |
aactaagaaactatgttttaagttagaggttattactcctatgtaggttaccggaggggtagggtgtagtcaattaaatgctccctacatgtgtagtggt |
40441253 |
T |
 |
| Q |
218 |
tttcaccggtatcttcatcaaattg |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
40441254 |
tttcactggtatcttcatcaaattg |
40441278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University