View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18299_low_9 (Length: 269)
Name: NF18299_low_9
Description: NF18299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18299_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 259
Target Start/End: Original strand, 40978209 - 40978451
Alignment:
| Q |
17 |
ataaaggagtgtctgttccctaaaaaaggtatactaaaactgcaaatggtgtcgtgttcttatcatgaaaatgggatcaaatagtgacatgagtagtaat |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40978209 |
ataaatgagtgtctgttccctaaaaaaggtatactaaaactgcaaatggtgtcgtgttcttatcatgaaaatgggatcaaatagtgacatgagtagtaat |
40978308 |
T |
 |
| Q |
117 |
cataacaagaagacgcttcaatacatctgtcctcaacttccactcatggtaaactcataattttctctcttttgcttttttcacttcattattctgtaac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40978309 |
cataacaagaagacgcttcaatacatctgtcctcaacttccactcaaggtaaactcataattttctctcttttgcttttttcacttcattattctgtagc |
40978408 |
T |
 |
| Q |
217 |
aaaactataacttaatatatattgcttaattaagtcacctttg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40978409 |
aaaactataacttaatatatattgcttaattatgtcacctttg |
40978451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University