View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18300_low_10 (Length: 287)
Name: NF18300_low_10
Description: NF18300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18300_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 271
Target Start/End: Complemental strand, 28618217 - 28617956
Alignment:
| Q |
10 |
agatgaatcatcaccaacgatattggacgggttatggcaaggtgctgtgttaatatcgccgttcttcttctggggcacttccatggtggcaatgaaagaa |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28618217 |
agatgaatcatcgccaacgatattggacgggttatggcaaggtgctgtgttaatatcgccgttcttcttctggggcacttccatggtggcaatgaaagaa |
28618118 |
T |
|
| Q |
110 |
gtgattccgaaacacggtccnnnnnnngtttcttcttttcgtctcattcctgctgggttccttcttgttgcttttgctgcttctagaggaagggagtttc |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28618117 |
gtgattccgaaacacggtcctttttttgtttcttcttttcgtctcattcctgccgggttccttcttgttgcttttgctgcttctagaagaagggagtttc |
28618018 |
T |
|
| Q |
210 |
cttctagcttcaatgcctggctctccatcgccatatttgctctcgtcgatgctgcttgcttt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28618017 |
cttctagcttcaatgcctggctctccatcgccatatttgctctcgtcgatgctgcttgcttt |
28617956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 40 - 271
Target Start/End: Complemental strand, 28622484 - 28622253
Alignment:
| Q |
40 |
gttatggcaaggtgctgtgttaatatcgccgttcttcttctggggcacttccatggtggcaatgaaagaagtgattccgaaacacggtccnnnnnnngtt |
139 |
Q |
| |
|
||||||| ||||||| ||||||||||| |||||||| |||||||| ||| | |||||||| ||||||||||||||||| || ||||||| ||| |
|
|
| T |
28622484 |
gttatgggaaggtgcagtgttaatatcaccgttctttttctggggaactgcaatggtggcgatgaaagaagtgattcctaattacggtccttttttcgtt |
28622385 |
T |
|
| Q |
140 |
tcttcttttcgtctcattcctgctgggttccttcttgttgcttttgctgcttctagaggaagggagtttccttctagcttcaatgcctggctctccatcg |
239 |
Q |
| |
|
| ||||||||| | ||||| |||||||| |||||||||||||||||||||| ||||||||||| || |||||| | |||||||| ||||| ||||||| |
|
|
| T |
28622384 |
gcgtcttttcgtttaattccagctgggtttcttcttgttgcttttgctgcttttagaggaagggctttaccttctggtttcaatgcttggctttccatcg |
28622285 |
T |
|
| Q |
240 |
ccatatttgctctcgtcgatgctgcttgcttt |
271 |
Q |
| |
|
| |||||||| || |||||||||||||||||| |
|
|
| T |
28622284 |
cgatatttgcacttgtcgatgctgcttgcttt |
28622253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University