View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18301_high_16 (Length: 368)
Name: NF18301_high_16
Description: NF18301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18301_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 34 - 345
Target Start/End: Complemental strand, 27067806 - 27067495
Alignment:
| Q |
34 |
ctaatgctaaaattatccgtgacaagatctatcaaaaatctcagttattgcttacatggcaacataattttattttgnnnnnnncagtacaaactacttt |
133 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
27067806 |
ctaatgctaaaattatcggtgacaagatctatcaaaaatctcagttattgcttacatgacaacataattttattttgaaaaaaacagtacaaactacttt |
27067707 |
T |
 |
| Q |
134 |
aattctataaattattggttacagcaacactgaaactcactacactttccaccttatcccttccttcactctttctcaatgttatctctatagaaaccat |
233 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27067706 |
aattctataaattattgcttacagcaacactgaaactcactacactttccaccttatcccttccttcactctttctcaatgttatctctatagaaaccat |
27067607 |
T |
 |
| Q |
234 |
tgaagaagtataaacataaatattcacataattcatgaagaaaatgcagaaacaacttggtcacattattcacaccctcttcatccttctctccatactc |
333 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27067606 |
tgaagaaatataaacataaatattcacataattcatgaagaaaatgcagaaacaacttggtcacattattcacaccctcttcatccttctctccatactc |
27067507 |
T |
 |
| Q |
334 |
actgtaagttta |
345 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27067506 |
actgtaagttta |
27067495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University