View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18301_low_29 (Length: 257)

Name: NF18301_low_29
Description: NF18301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18301_low_29
NF18301_low_29
[»] chr8 (1 HSPs)
chr8 (12-257)||(38096486-38096731)


Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 257
Target Start/End: Original strand, 38096486 - 38096731
Alignment:
12 gcagagatgaaagcaaagcagcaggaagggaggctgagcaatgtggggaccacaagcaaaagaagggagagtgttgatgaagagaaagtgtattctggtg 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||    
38096486 gcagagatgaaagcaaagcagcaggaagggaggctgagcaatgtggggacaacaagcaagagaagggagagtgttgatgaagagaaagtgtattctggtg 38096585  T
112 atgaagatatatgtgtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagc 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38096586 atgaagatatatgtgtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagc 38096685  T
212 aaaccgggttgcttttcaagctgaacctgtgctcaagaaatctaat 257  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
38096686 aaaccgggttgcttttcaagctgaacctgtgctcaagaaatctaat 38096731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University