View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18301_low_35 (Length: 225)
Name: NF18301_low_35
Description: NF18301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18301_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 8455842 - 8455648
Alignment:
| Q |
20 |
accaattctctagaacactctttaatannnnnnnnnaaatttcactcaattaaattagatcaacaggtaacataaaaaagagtcatgtatgcttcaaaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
8455842 |
accaattctctagaacactctttaatatttttttttaaatttcactcaattaaattagatcaacaagtaacataaaaaagagtcatgcatgcttcaaaat |
8455743 |
T |
 |
| Q |
120 |
aaccactcccacaataagggaaagatttgtaaaaaacatttttcactgtctttcctttaaatttaagaaaaatgctaacaggtactttaaatatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
8455742 |
aaccactcccacaataagggaaagatttgtaaaaaacatttttcactgtctttcctttaaatttaagaaaaatactaacaagtactttaaatatt |
8455648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University