View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18302_high_16 (Length: 406)
Name: NF18302_high_16
Description: NF18302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18302_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 36 - 180
Target Start/End: Complemental strand, 19505795 - 19505652
Alignment:
| Q |
36 |
aagagaaactgcagtcatgagtgattaattcgaccgcaaaaataaattattcaagaaaatactcatcaatcaatgttgttattatattaaaaaagttagg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
19505795 |
aagagaaactgcagtcatgagtgattaattcgaccgcaaaaataaattattcaagaaaatactcatcaatcactgttgttattatattaaaaaa-ttagg |
19505697 |
T |
 |
| Q |
136 |
caggtcccgataaaatatttgagtggaagctgcaatgactgagtg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19505696 |
caggtcccgataaaatatttgagtggaagctgcaatcactgagtg |
19505652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 242 - 323
Target Start/End: Complemental strand, 19505499 - 19505418
Alignment:
| Q |
242 |
ccatttcgtggcatataagtatattgattgattcatgcttcacggattcgatcattcattgagctatactcgaattggtata |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19505499 |
ccatttcgtggcatataactatattgattgattcatgcttcacggattcgatcattcattgagctatactcgaattggtata |
19505418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 350 - 390
Target Start/End: Complemental strand, 19505396 - 19505356
Alignment:
| Q |
350 |
tataaaagtgcatgtaatgaacttgttgagagcttctaaat |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19505396 |
tataaaagtgcatgtaatgaacttgttgagagcttctaaat |
19505356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University