View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18302_high_20 (Length: 357)
Name: NF18302_high_20
Description: NF18302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18302_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 19333613 - 19333771
Alignment:
| Q |
16 |
attaggtctttcggaaaagaacatcgtcgtcttccctcgattgatgatcgagttttcgaggaggagaaagaatgtgttactgggtctgaagaagatgaat |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19333613 |
attaggtctttcggaaaaggtcatcgtcgtctttcctcgattgatgatcgagttttcgaggaggagaaggaatgtgttactgggtctgaagaagatgaa- |
19333711 |
T |
|
| Q |
116 |
tttgctcgtacatgatctaagtatctagcatttctaaatttgaattgtctttgttatatt |
175 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19333712 |
tttgctcctacatgatctaagtatctagcatttctaaatttgaattgtctttgttatatt |
19333771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 233 - 355
Target Start/End: Original strand, 19333829 - 19333954
Alignment:
| Q |
233 |
tttgtctctaatttttgttgctattttaactttttctagtatagtataataagtaaaatattgccaagtttaa-------tcattattcactgctcttgt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||| | ||| ||||||| ||| | |||||| ||||||| |
|
|
| T |
19333829 |
tttgtctctaatttttgttgctattttaacttttt----tctagtataataagtaaaatgtagccgagtttaattactgttcaatgttcactactcttgt |
19333924 |
T |
|
| Q |
326 |
gcttagtagcaaaacattctcaataatatt |
355 |
Q |
| |
|
||| || ||||||||||| ||||||||||| |
|
|
| T |
19333925 |
gctcagcagcaaaacattgtcaataatatt |
19333954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University