View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18302_high_21 (Length: 353)
Name: NF18302_high_21
Description: NF18302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18302_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 330
Target Start/End: Complemental strand, 16906241 - 16905923
Alignment:
| Q |
19 |
aattgtgatgtatcaaggtctctttaactgcatatccgaggtaccatagttaatgtcctattcctttaatatctcactttttctcaattctaccccttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16906241 |
aattgtgatgtatcaaggtctctttaactgcatatccgaggtaccatagttaatgtcctattcctttaatatctcactttttctcaattctaccccttat |
16906142 |
T |
 |
| Q |
119 |
atcctttttcactaatatcatcatcaccaattccttttgctttgt---cttcactcactaagtacatgatcttccccttttctatctg------tctcta |
209 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16906141 |
atcttttttcactaatatcatcatcaccaattccttttgctttgtcttcttcactcactaagtacatgatcttccccttttctatctgtctctatctcta |
16906042 |
T |
 |
| Q |
210 |
tctaaccatctctagtcattttatcaatccttttctttgccaaactcannnnnnnncttgctatttttgaaacaagatttagtgcaatgagattatccaa |
309 |
Q |
| |
|
||| || ||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16906041 |
tctcactatctctagtcattttatcaat-cttttctttaccaaactca-tttttttcttgctatttttgaaacaagatttagtgcaatgagattatccaa |
16905944 |
T |
 |
| Q |
310 |
gttaatattgatagttatgtt |
330 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
16905943 |
gttgatattgatagttatgtt |
16905923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University