View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18302_high_25 (Length: 291)
Name: NF18302_high_25
Description: NF18302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18302_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 281
Target Start/End: Original strand, 51992980 - 51993227
Alignment:
| Q |
30 |
acatacatgactcaagaagagttctttctctatgtcaatggaatgatagcaaggtggaacaaatgatggccgtgaaaatatcatcgagccaacaacacta |
129 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51992980 |
acatgcatgactcaagaagagttctttctctatgtcaatggaatgatagcaaggtggaacaaatgatggccgtgaaaatatcatcgagccaacaacacta |
51993079 |
T |
 |
| Q |
130 |
ggatgcactttatagcagcccctcaattttagtcttttctcatagtttcatgtgcttcactcccttctatgtgaagactaacctaaatgtagacaaatta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51993080 |
ggatgcactttatagcagcccctcaattttagtcttttctcatagtttcatgtgcttctctcccttctatgtgaagactaacctaaatgtagacaaatta |
51993179 |
T |
 |
| Q |
230 |
ttgctccaatatatacttacttcaatctccaaaagctctccctttgcttctc |
281 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
51993180 |
ttgctcca----atacttacttcaatctccaaaagctctcccattgtttctc |
51993227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 94 - 154
Target Start/End: Complemental strand, 8187344 - 8187284
Alignment:
| Q |
94 |
gatggccgtgaaaatatcatcgagccaacaacactaggatgcactttatagcagcccctca |
154 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
8187344 |
gatggccttgaaaatatcatcgagtcaacaacatcaggatgcacattatagcagcgcctca |
8187284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 91 - 142
Target Start/End: Complemental strand, 55505361 - 55505310
Alignment:
| Q |
91 |
aatgatggccgtgaaaatatcatcgagccaacaacactaggatgcactttat |
142 |
Q |
| |
|
|||||||||| |||||||| ||| ||| |||||||||||| ||||||||||| |
|
|
| T |
55505361 |
aatgatggccttgaaaataccattgagtcaacaacactagtatgcactttat |
55505310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University