View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18302_high_27 (Length: 283)
Name: NF18302_high_27
Description: NF18302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18302_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 274
Target Start/End: Complemental strand, 25840482 - 25840225
Alignment:
| Q |
18 |
ttatcaacattggatatatttggaatcacaatgcaacttgacaaagtatatcactgtataacacttgaaattctaaaatgtagattgtccaaaaccacag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25840482 |
ttatcaacattggatatatttggaatcacaatgcaacttgacaaagtatatcactgtataacacttgaaattctaaaatgtagattgtccaaaaccacgg |
25840383 |
T |
 |
| Q |
118 |
accctaattttgctaaactcactaggaatttgatacgtaaaatttggggtttggcattgacttgaagagtgcaa-atttgtttctgtatcaatcggtgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
25840382 |
accctaattttgctaaactcactaggaatttgatacgtaaaatttggggtttggcattgacttgaagagtgcaatttttttttctgtatcaatcggtgct |
25840283 |
T |
 |
| Q |
217 |
ttcattgagagaacctcctatgacatacccgtatcactcatcctacattacttcatct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25840282 |
ttcattgagagaacctcctatgacatacccgtatcactcatcctacattactccatct |
25840225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University