View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18302_low_35 (Length: 249)
Name: NF18302_low_35
Description: NF18302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18302_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 51989667 - 51989440
Alignment:
| Q |
16 |
atgtatgtaatggtgctctcaaatcctctgaaaacaaaattatattatatatttacttaattgttcaagaaaggaagatgtcaatgagatccaagtgaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51989667 |
atgtatgtaatggtgctctcaaatcctttgaaaacaaaattatattgtatatttacttaattgttcaagaaaggaagatgtcaatgagatccaagtgaaa |
51989568 |
T |
|
| Q |
116 |
agatagtgacattctgttcttgcttcgctatataaggggtaccttgtcggtgatgtaccgtgatcaatgtcttggaataactatctatattgttaaaagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51989567 |
agatagtgacattctgttcttgcttcgctatataaggggtaccttgtcggtgatgtaccgtgatcaatgtcttggaataactatctatatggttaaaagg |
51989468 |
T |
|
| Q |
216 |
gaatggatgatggtttgcttcatctcac |
243 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
51989467 |
gaatggatgatggtttgcttcatatcac |
51989440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University