View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18304_high_17 (Length: 264)

Name: NF18304_high_17
Description: NF18304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18304_high_17
NF18304_high_17
[»] chr8 (1 HSPs)
chr8 (88-244)||(14225478-14225635)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 88 - 244
Target Start/End: Complemental strand, 14225635 - 14225478
Alignment:
88 tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgataaaaaa-taaaccagcacagtca 186  Q
    ||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| ||||    
14225635 tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca 14225536  T
187 aacagctcgaatagtgagaggtttaagagtgatgtggtggtcgtgctagagataactc 244  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
14225535 aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtgctagagataactc 14225478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University