View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18304_low_21 (Length: 275)

Name: NF18304_low_21
Description: NF18304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18304_low_21
NF18304_low_21
[»] chr7 (1 HSPs)
chr7 (1-260)||(34701128-34701387)


Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 34701387 - 34701128
Alignment:
1 aaagagaatagccatgaaagtgctgagaatcgaacctcgaaatgtagtagaaggtcgttgtcgatggagaggacggaacaacagcaatttcaacaacaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34701387 aaagagaatagccatgaaagtgctgagaatcgaacctcgaaatgtagtagaaggtcgttgtcgatggagaggacggaacaacagcaatttcaacaacaag 34701288  T
101 ctcaatctggttttgatggaattgaagatgaggatgagaagaggaaagcaaggttgatgaggaatagagaaagtgcacagctttcaaggcagaggaagaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34701287 ctcaatctggttttgatggaattgaagatgaggatgagaagaggaaagcaaggttgatgaggaatagagaaagtgcacagctttcaaggcagaggaagaa 34701188  T
201 gcattatgtggaggagcttgaggagaaagtgagatcaatgcattcaacaattactgattt 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34701187 gcattatgtggaggagcttgaggagaaagtgagatcaatgcattcaacaattactgattt 34701128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University