View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18304_low_33 (Length: 234)
Name: NF18304_low_33
Description: NF18304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18304_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 15 - 141
Target Start/End: Complemental strand, 25085589 - 25085463
Alignment:
| Q |
15 |
gatttaatgtaggctgatatagttttgcggggatatgctgcttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattgaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25085589 |
gatttaatgtaggctgatatagttttgcggggatatgctgcttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattgaata |
25085490 |
T |
|
| Q |
115 |
taataactgatgaaggcatcttttgat |
141 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
25085489 |
taatgactgatgaaggcatcttttgat |
25085463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 15 - 141
Target Start/End: Complemental strand, 25091483 - 25091357
Alignment:
| Q |
15 |
gatttaatgtaggctgatatagttttgcggggatatgctgcttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattgaata |
114 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25091483 |
gatttgatgtaggctgatatagttttgaggggatatgctgcttggacttcaaggcatgctctccaagttttggataaaatatttcccaaggtattgaata |
25091384 |
T |
|
| Q |
115 |
taataactgatgaaggcatcttttgat |
141 |
Q |
| |
|
|||| || | ||| |||||||||||| |
|
|
| T |
25091383 |
taatgacaaaagaatgcatcttttgat |
25091357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 15 - 112
Target Start/End: Complemental strand, 25064205 - 25064108
Alignment:
| Q |
15 |
gatttaatgtaggctgatatagttttgcggggatatgctgcttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattgaa |
112 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
25064205 |
gatttgatgtaggctgatatagttttgaggggatatgctgcttggaattcaaggcatgctctccaagttttggatagaatttttcctaaggtattgaa |
25064108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 25 - 110
Target Start/End: Complemental strand, 25073930 - 25073845
Alignment:
| Q |
25 |
aggctgatatagttttgcggggatatgctgcttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattg |
110 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
25073930 |
aggctgatatacttttacggggatatgctggttggaattcaaggcatgctctccaagttttggataaaatattttccaaggtattg |
25073845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 21 - 111
Target Start/End: Complemental strand, 25059412 - 25059322
Alignment:
| Q |
21 |
atgtaggctgatatagttttgcggggatatgctgcttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattga |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||| ||||| ||| |||||| ||||| | || |||||||||||||||| |
|
|
| T |
25059412 |
atgtaggttgatatagttttgcggggatatgctggttggaattcaacgcgtggtctacaagttgtggatgatatttttcctaaggtattga |
25059322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 234
Target Start/End: Complemental strand, 25085408 - 25085380
Alignment:
| Q |
206 |
tgttgaattaaacctttatacttttttcc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25085408 |
tgttgaattaaacctttatacttttttcc |
25085380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 5039737 - 5039682
Alignment:
| Q |
56 |
ttggaattcaaggcgtgctctgcaagttttggataaaatatttcctaaggtattga |
111 |
Q |
| |
|
||||||||||||||||||| | || ||| |||||| ||||||||| |||||||||| |
|
|
| T |
5039737 |
ttggaattcaaggcgtgctgttcaggttctggatacaatatttcccaaggtattga |
5039682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University