View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18304_low_37 (Length: 223)
Name: NF18304_low_37
Description: NF18304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18304_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 42700356 - 42700551
Alignment:
| Q |
11 |
gagaagaaagagagggaaataaaacaaagacaaaagcat-ggaagtggtgtagaggaagaagatggagactctgaaaggtgcgattccagataaactaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
42700356 |
gagaagaaagagagggaaataaaacaaagacaaaagcgttggaagtggtgtagaggaagaagatggatactctgaaaggtgcgattccagagaaactaaa |
42700455 |
T |
|
| Q |
110 |
acaagcaattagggatagcactgtaaacactcttcaagacacatgttcttctcttcatcacttctttcttcatttcgacccttttcaccaggtact |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42700456 |
acaagcaattagggatagcactgtaaacactcttcaagacacatgttcttctcttcatcacttctttcttcatttcgacccttttcaccaggtact |
42700551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University