View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18305_high_12 (Length: 382)
Name: NF18305_high_12
Description: NF18305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18305_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 19 - 379
Target Start/End: Complemental strand, 39663059 - 39662699
Alignment:
| Q |
19 |
tgtacttcgcaagtatttgatgagatatttgatttgatttacaacttttatattatgagttggtgaatgtctaatagtgtagtgttgcgtgctctttttc |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663059 |
tgtacttcgcaagtatttgatgagacatttgatttgatttacaacttttatattatgagttggtgaatgtctaatagtgtagtgttgcgtgctctttttc |
39662960 |
T |
|
| Q |
119 |
ctgcaaagttatctataaacatgccccaatttattccgtagaactttgaagttttaaatgcttaatttccaagctattagatgtttatgttatgtatatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
39662959 |
ctgcaaagttatctataaacatgccccaatttattccgtagaactttgaagttttaaatgcttaatttccaagctattagatgtttgcgtcatgtatatt |
39662860 |
T |
|
| Q |
219 |
accgtgtcttgctctgcttgccttcttttcattcataggagtaaaaggtaaaggttctttgtagacgaaaagagtctttatctaagtctgcgagagaaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39662859 |
accgtgtcttgctctgcttgccttcttttcattcataggagtaaaaggtaaaggttctttgtagacgaaaagagtctttatctaagtctgcgagagaaaa |
39662760 |
T |
|
| Q |
319 |
gtatttctttcaaatgaagtgctatgattggtctcgggaatcatatgcaatcctttgcttc |
379 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39662759 |
gtatttctttgaaatgaagtgctatgattggtctcgggaatcatatgcaatcctttgcttc |
39662699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 40100713 - 40100650
Alignment:
| Q |
28 |
caagtatttgatgagatatttgatttgatttacaa-cttttatattatgagttggtgaatgtcta |
91 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
40100713 |
caagtgttttatgagatatt-gatttgatttacaaacttctatattatgatttggtgaatgtcta |
40100650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University