View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18305_high_17 (Length: 305)
Name: NF18305_high_17
Description: NF18305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18305_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 21 - 290
Target Start/End: Complemental strand, 34398613 - 34398344
Alignment:
| Q |
21 |
tattcgtgatttgatggaagaattaacctaaattgattgttccattttctgcaatgatataacgaatgcaaaacaactgaaattaaggaccatgtaacgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34398613 |
tattcgtgatttgatggaagaattaacctaaattgattgttccattttctgcaatgatataacgaatgcaaaacaactgaaattaaggaccatgtaacgt |
34398514 |
T |
 |
| Q |
121 |
ctaaaagtggacaaacaatttgaatgaaatcctcatgtggtaggaacataattaaatctctttggtacccactgattgcctattttcaattgatatatat |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34398513 |
ctaaaagtgtacaaacaatttgaatgaaatcctcatgtggtaggaacataattaaatctctttggtacccactgattgcctattttcaattgatatatat |
34398414 |
T |
 |
| Q |
221 |
acctaagaacgttctgttcaattgtctggtggttattaaccattcgagacaaaaggaataaaatcattct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34398413 |
acctaagaacgttctgttcaattgtctggtggttattaaacattcgagacaaaaggaataaaatcattct |
34398344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University