View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18306_low_17 (Length: 305)
Name: NF18306_low_17
Description: NF18306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18306_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 39229558 - 39229837
Alignment:
| Q |
18 |
catgtgattatttttagtctgtgcttgagaaggagcgcaaaggagattatctcggaaaaactgttcaggtgataaatcgtgcgcgtgtttgtgctattta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39229558 |
catgtgattatttttagtctgtgcttgagaaggagcgcaaaggagattatctcggaaaaactgttcaggtgataaatcgtgcacgtgtttgtgctattta |
39229657 |
T |
 |
| Q |
118 |
tacttgttaattgattgctgaataatggatattttgtgtggataatgaagataagattactgagttgttgagannnnnnnngatgaaataggtggttccg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
39229658 |
tacttgttaattgattgctgaataatggatattttgtgtggataatgaagataagattactgagctgttgagattttttttgatgaaataggtggttccg |
39229757 |
T |
 |
| Q |
218 |
catatcaccgatgcaatcagaaactggattgaatcggttgctgtgatcccggttgatggaaatgaagaccctgatgatgt |
297 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39229758 |
catatcactgatgcaatcagaaactggattgaatcggttgctgtgatcccggttgatggaaatgaagaccctgctgatgt |
39229837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 87
Target Start/End: Original strand, 26519449 - 26519507
Alignment:
| Q |
29 |
ttttagtctgtgcttgagaaggagcgcaaaggagattatctcggaaaaactgttcaggt |
87 |
Q |
| |
|
||||||||||| ||||||||||| | | |||||||||||| ||||| ||||||||||| |
|
|
| T |
26519449 |
ttttagtctgttattgagaaggagagaagaggagattatcttggaaagactgttcaggt |
26519507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University