View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18306_low_31 (Length: 214)

Name: NF18306_low_31
Description: NF18306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18306_low_31
NF18306_low_31
[»] chr3 (1 HSPs)
chr3 (148-198)||(52530914-52530967)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 52530914 - 52530967
Alignment:
148 ggaaataaatgaatgacattacat---atgatcaggggaagaagtttcataagt 198  Q
    ||||||||||||||||||||||||   |||||||||||||||||||||||||||    
52530914 ggaaataaatgaatgacattacatatgatgatcaggggaagaagtttcataagt 52530967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University