View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18307_low_12 (Length: 256)
Name: NF18307_low_12
Description: NF18307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18307_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 45107064 - 45106839
Alignment:
| Q |
19 |
aaaggtgttgtggaagtaaacatgtactctaccgcattggatagaaatgtaagtactaaaatctctccccttcatcacacacattttctagggaaaaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107064 |
aaaggtgttgtggaagtaaacatgtactctaccgcattggatagaaatgtatgtactaaaatctctccccttcatcacacacattttctagggaaaaaat |
45106965 |
T |
|
| Q |
119 |
tgaattaaccgtagaaattgagtatgcttttatttttaattttctgttcttgatcaaatatacttttgaatgcaggatatccgtccgaaaatatattgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45106964 |
tgaattaaccgtagaaattgagtatgcttttattttaaattttctgttcttgatcaaatatacttatgaatgcaggatatccgtccgaaaatatattgtg |
45106865 |
T |
|
| Q |
219 |
tggttatattcataatcatggtttca |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45106864 |
tggttatattcataatcatggtttca |
45106839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University