View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18307_low_14 (Length: 244)
Name: NF18307_low_14
Description: NF18307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18307_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 244
Target Start/End: Complemental strand, 39296239 - 39296011
Alignment:
| Q |
15 |
atctctctcaaaaaaggcacattgctcgcttaatgcatgaatggtaacagatagattctgctttatttctgctcgcttaatattgctgcattttaaggct |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39296239 |
atctctctcaaaaa-ggcacattgctcgcttaatgcatgaatggtaacagatagattctgctttatttctgctcgcttaatattgctgcattttaaggct |
39296141 |
T |
|
| Q |
115 |
agattcatacccaaatctttggttcagctatacacctcatccaaatacttttggttgtgttttgaatgtttaaaccatatatatcataaaacaatattta |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39296140 |
agattcaaacccaaatctttggttcagctatacacctcatccaaatacttttggttgtgttttgaatgtttaaaccatatatatcataaaacaatattta |
39296041 |
T |
|
| Q |
215 |
tatgctttcattctttgatttggatccctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39296040 |
tatgctttcattctttgatttggatccctc |
39296011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University