View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18307_low_4 (Length: 364)
Name: NF18307_low_4
Description: NF18307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18307_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 160 - 291
Target Start/End: Complemental strand, 12819285 - 12819154
Alignment:
| Q |
160 |
ttgctttcaccaacttttgttttcaagaaaatagtgcagaaaatatggtctatatctatatactaaaagaaaatctctctttgaatgttttcccactctc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12819285 |
ttgctttcaccaacttttgttttcaagaaaatagtgcagaaaatatggtctatatctatatactataagaaaatctctctttgaatgttttcccactctc |
12819186 |
T |
 |
| Q |
260 |
gattttattgggtgtcttatatatttttaaca |
291 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
12819185 |
gatttcattgggtgtcttatatatttttaaca |
12819154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 15 - 151
Target Start/End: Complemental strand, 12819472 - 12819336
Alignment:
| Q |
15 |
atgaataatactgcatagtactctatgatacatacctcaatggataatgataactgattcatacgaagaatgtcgtggtcctttgacattgttccttata |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12819472 |
atgaataatactgcatagtacgctatgatacatacctcaattgataatgataactgattcatacgaagaatgccgtggtcctttgacattgttccttata |
12819373 |
T |
 |
| Q |
115 |
ttgcttttctgatatctttgcatgacctgttgagttt |
151 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12819372 |
ttgcttttctgagatctttgcaggacctgttgagttt |
12819336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University