View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18307_low_9 (Length: 270)
Name: NF18307_low_9
Description: NF18307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18307_low_9 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 243567 - 243821
Alignment:
| Q |
1 |
gagtacctttttgacaagctgtactctaaatcattattactctctcattttggcatgatgagttttcttttcaaattatgatgttgcggttgggagtgta |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
243567 |
gagtacctttttgacaagttgtactctaaatcattattactctctcattttggcatgatgagttttcttttcaaattatg---ttgcggttgggagcgtg |
243663 |
T |
 |
| Q |
101 |
ttttcnnnnnnnttatgcattctaaacctagagcaatctctcatttaacgatcgaaataacataacgattgtgaagattgtcgtcactaaatattgaatt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||| |||||||||| |
|
|
| T |
243664 |
ttttcaaaaaaattatgcattctaaacctagagcaatctctcatttaacgattgaaataacataacgattgtgaagattgtcatctctacatattgaatt |
243763 |
T |
 |
| Q |
201 |
aaatttcatggatccagtatcgccaaaataagattcaataaatatcttctcacaggtt |
258 |
Q |
| |
|
|| ||||||||||| | |||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
243764 |
aagtttcatggatcaactatcgccaaaataaaattcgataagtatcttctcacaggtt |
243821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University