View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_high_10 (Length: 541)
Name: NF18309_high_10
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 522; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 522; E-Value: 0
Query Start/End: Original strand, 1 - 534
Target Start/End: Original strand, 38357212 - 38357745
Alignment:
| Q |
1 |
tctctcttcctctgtatagcttctgaattcaacaccttccaccacttctccagcttttgcatgatcactattagaatctaatattccacattctattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357212 |
tctctcttcctctgtatagcttctgaattcaacaccttccaccacttctccagcttttgcatgatcactattagaatctaatattccacattctattgct |
38357311 |
T |
 |
| Q |
101 |
attgccttagcagtgaatatgttatcgccggtgatcatcttaatttcaactcctgcagctttgcaagtttccacagctttcttagtgtttggtctgcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357312 |
attgccttagcagtgaatatgttatcgccggtgatcatcttaatttcaactcctgcagctttgcaagtttccacagctttcttagtgtttggtctgcatg |
38357411 |
T |
 |
| Q |
201 |
gatccttgaggccaacgatgccaagcaatgtcaatccatcttctctaagcatttgatgtgattttttctcccttttgatcatataatcaatatcttcgga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357412 |
gatccttgaggccaacgatgccaagcaatgtcaatccatcttctctaagcatttgatgtgattttttctcccttttgatcatataatcaatatcttcgga |
38357511 |
T |
 |
| Q |
301 |
atctgaaatctccgtgtgagcaaaagcaatacatcttagactactagcagccataccttgaatgattctctcaattttactgcgttcttcttcatcaagg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38357512 |
atctgaaatctccgtgtgagcaaaagcaatacatcttagactactagcagccataacttgaatgattctctcaattttactccgttcttcttcatcaagg |
38357611 |
T |
 |
| Q |
401 |
gacttcctcgcgccgttactatcaatatagtttgtacacattgcaagtatcatctctgcagctcctttccaatgcacgtgaacgctgttgtcgtcgttct |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357612 |
gacttcctcgcgccgttactatcaatatagtttgtacacattgcaagtatcatctctgcagctcctttccaatgcacgtgaacgctgttgtcgtcgttct |
38357711 |
T |
 |
| Q |
501 |
ctttccttatagcaacaccgcttcgtttattctc |
534 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
38357712 |
ctttccttatagcaacaccgcttcgtttcttctc |
38357745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University