View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_high_22 (Length: 410)
Name: NF18309_high_22
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 14 - 392
Target Start/End: Complemental strand, 16996196 - 16995822
Alignment:
| Q |
14 |
catagggagatgtgtaggtgtcacaaatggatttgatctattgaagttgggggattgatcaactatgttttatttttggctccatcactatccttggtgt |
113 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||| |||||||| |
|
|
| T |
16996196 |
catagggagatgtgtgggtgtcacaaatggatttgatctattgaagttgggggattgatc---tatgatttatttttggctccatctttattcttggtgt |
16996100 |
T |
|
| Q |
114 |
atgtggtccctaatgnnnnnnnn-accctatgagtttggttgtgggatatggggtgtttggttgggaagnnnnnnnaagggttgttgttttattttattc |
212 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
16996099 |
gc-tggtccctaatgtttttttttaccct--gagtttggttgtgggatatggggtgtttggttgggaagtttttt-atgggttgttgttttattttattc |
16996004 |
T |
|
| Q |
213 |
ttccggtgagtagttttgcttgtctccttatgccat----ctgagttgtaaattcatgtcaccaccatttatatctagcaccaaactcaatagtactgag |
308 |
Q |
| |
|
|||| |||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16996003 |
ttccagtgattagttttgcttgtctccatatgccattgatctgagttgtaaattcatgtcaccaccatttatatctagcaccaaactcaatag--ctgag |
16995906 |
T |
|
| Q |
309 |
catgaaggggtgtataggaaaaaccaagtcgcgtcacccctcaccctataagccggtttagtgcggatgatatgtgacccttat |
392 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
16995905 |
catgaaggggtgtaaaggaaaaaccaagtcgcgtcacccctcaccgtataagctggtttagtgcggatggtatatgacccttat |
16995822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University