View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_high_34 (Length: 335)
Name: NF18309_high_34
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 13715604 - 13715302
Alignment:
| Q |
1 |
agagggtgtattttggtctctgcttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715604 |
agagggtgtattttggtctctgtttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctca |
13715505 |
T |
|
| Q |
101 |
gcaacaatataaatcaacctctcgacctatcatcttgggatattccgctgcattgctcgtagaatgtttggagccctccagtgaaacaaatcatgctttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715504 |
gcaacaatataaatcaacctctcgacctatcatcttgggatattccgctacattgctcgtagaatgtttggagccctccagtgaaacaaatcatgctttc |
13715405 |
T |
|
| Q |
201 |
tgccaagcttcatactatttggattatttgggttgaacaaaacaaacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatt |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715404 |
tgccaagcttcat---------attatttgggttgaacaaaacagacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatt |
13715314 |
T |
|
| Q |
301 |
tatgaagttcat |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13715313 |
tatgaagttcat |
13715302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University