View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_high_43 (Length: 247)
Name: NF18309_high_43
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 45685315 - 45685086
Alignment:
| Q |
1 |
cttctctctagaattttcagcttacatgtggtccatttatgnnnnnnnngagcaaacaaattttagatttctgaaaatttagacactgtatcactgcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
45685315 |
cttctctctagaattttcagcttacatgtggtccatttatgtttttgttgagcaaacaaattttagatttctgaaaatttaaacact--atcactgcaaa |
45685218 |
T |
 |
| Q |
101 |
gattaataccatgagatcgtttacaaagagtaaagataaggcctgaaatgcgtttacaaagagttaggctcaatttaaaaacctaatatatttaaatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45685217 |
gattaataccatgagatcgtttacaaagagtaaagataaggcctgaaatgcgtttacaaagagttaggctcaatttaaaaacctaatatatttaaatata |
45685118 |
T |
 |
| Q |
201 |
atatggaaagaaagataaggaacacgtcacag |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
45685117 |
atatggaaagaaagataaggaactcgtcacag |
45685086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University