View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_low_21 (Length: 412)
Name: NF18309_low_21
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 262 - 404
Target Start/End: Complemental strand, 32184508 - 32184370
Alignment:
| Q |
262 |
taacaccgactaatttccattgcaaaatttatccgtcataaaacaaggcaggcgagtgcttccatctcaactggattttctccacatgaaagatttagaa |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32184508 |
taacaccgactaatttccattgcaaaatttatccgtcataaaacaaggc----gagtgcttccatctcaactggattttctccacatgaaggatttagaa |
32184413 |
T |
 |
| Q |
362 |
tcgaactcttgaccatttactgaaaatatgttattcctttgct |
404 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32184412 |
tcgaactcttgaccatctacttaaaatatgttattcctttgct |
32184370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University