View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_low_32 (Length: 347)
Name: NF18309_low_32
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 11 - 167
Target Start/End: Original strand, 2793993 - 2794149
Alignment:
| Q |
11 |
aagaagattaacattgagaaactgcttaaccctatcactgatactgtgtttaatcaccttgtttcgattggaaaggttataactgattttctggagtttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2793993 |
aagaagattaacattgagaaactgcttaaccctatcactgatactgtgtttaatcaccttgtttcgattggaaagcttataactgattttctggagtttg |
2794092 |
T |
 |
| Q |
111 |
aggatgttgagggtggttttgattcttttgacggtgttgcagtggaatttgaagaga |
167 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794093 |
aggatgtggagggtggttttgattcttttgacggtgttgcagtggaatttgaagaga |
2794149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 235 - 331
Target Start/End: Original strand, 2794217 - 2794313
Alignment:
| Q |
235 |
ttttgaaataggtgactatgcaatgcaaataggtggtggaattgttgttgaagaaattgagaaagtagatgatgaagaattgaatgtgcatgatatt |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794217 |
ttttgaaataggtgactatgcaatgcaaataggtggtggaattgttgttgaagaaattgagaaagtagatgatgaagaattgaatgtgcatgatatt |
2794313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University