View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_low_42 (Length: 263)
Name: NF18309_low_42
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 40207805 - 40208021
Alignment:
| Q |
8 |
gcaccaattaggacccaatgttactacaggccattgagagtatttggctagaaatccaacaagatctactgatgaatcagcattatgttcaccccttgta |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207805 |
gcaccaattaggacccaatgttactgcaggccattgagagtatttggctagaaatccaacaacatctactgatgaatcagcattatgttcaccccttgta |
40207904 |
T |
|
| Q |
108 |
tacaatattgacatatcatagatcatatagagtaacaagcaatcaaataactgacaataggacgataaattcaa---gaagaaatggaactttgaacaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40207905 |
tacaatattgacatatcatagatcatatagagtaacaagcaatcaaataactgacaataggacgataaattcaagctgcagaaatggaactttgaacaat |
40208004 |
T |
|
| Q |
205 |
attaactttcaatgcaa |
221 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
40208005 |
attcactttcaatgcaa |
40208021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University