View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_low_49 (Length: 239)
Name: NF18309_low_49
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 65 - 221
Target Start/End: Original strand, 829113 - 829269
Alignment:
| Q |
65 |
aaaacacaatgtatggatcttgcaactcagtagagcaaggcaaaaccttgaaaagcacatagccttcctagcttgccctctgaatcaatctagcacaaca |
164 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
829113 |
aaaaaacaatgtatggatcttgcaactcagtagagcaaggcaaaaccttgaaaaacacatagccttcctagcttgccctctgaatcaatctagcacaaca |
829212 |
T |
|
| Q |
165 |
actttgatacaactccatacatcacaaatgaaattaagaaaagtagacaatggtact |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
829213 |
actttgatacaactccatacatcacaaatgaaattaagaaaaggagacaatggtact |
829269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 827742 - 827650
Alignment:
| Q |
1 |
aagataacaccaactagaagcaaaattcattctcatggaaacaacacagaatgaaaatgaaagaaaaacacaatgtatggatcttgcaactca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
827742 |
aagataacaccaactagaagcaaaattcattctcatggaaacaacacagaatgaaaatgaaagaaaaacacaatgtatggatcttgcaactca |
827650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 27864942 - 27865034
Alignment:
| Q |
1 |
aagataacaccaactagaagcaaaattcattctcatggaaacaacacagaatgaaaatgaaagaaaaacacaatgtatggatcttgcaactca |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||| | |||| ||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
27864942 |
aagataacatcaactagaagcaaaattcattctcagggaacaaccacaaaatgaaaatgaaaaaagaatgcaatgtatggatcttgcaactca |
27865034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University