View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_low_54 (Length: 213)
Name: NF18309_low_54
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 33 - 196
Target Start/End: Complemental strand, 10595712 - 10595549
Alignment:
| Q |
33 |
ctctaaatggaggtttaaaatattttctctaattggcttagcacaatttttgctcacaagtcacgtccatcatactcacaatttttgcactctaagaact |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595712 |
ctctaaatggaggtttaaaatattttctctaattggcttagcacaatttttgctcacaagtcacgtccatcatactcacaatttttgcactctaagaact |
10595613 |
T |
|
| Q |
133 |
aaatggaggactgaccttgcccttgcagtgacaatgacccccgtttttggtgagaagaggtttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595612 |
aaatggaggactgaccttgcccttgcagtgacaatgacccccgtttttggtgagaagaggtttc |
10595549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University