View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18309_low_55 (Length: 201)
Name: NF18309_low_55
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18309_low_55 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 25495397 - 25495197
Alignment:
| Q |
1 |
ttaccttctcttttcttcttctctttgtattttcattagcctttagtacactagttgatgaacaagtaatagtggacacaaatggaaaccctattttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25495397 |
ttaccttctcttttcttcttctctttgtattttcattagcctttagtacactagttgatgaacaagtagtagtggacacaaatggaaaccctattttccc |
25495298 |
T |
 |
| Q |
101 |
tggtgggagatactatctcatgccacctatctttggagcagcaggtggtggagtaaagcttggtcatgatacagaaagctcaacatgtccagttgcagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25495297 |
tggtgggagatactatctcatgccacctatctttggagcagcaggtggtggagtaaagcttggtcatgatacagaaagctcaacatgtccagttgcagta |
25495198 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
25495197 |
t |
25495197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 152
Target Start/End: Complemental strand, 24222409 - 24222332
Alignment:
| Q |
75 |
gacacaaatggaaaccctattttccctggtgggagatactatctcatgccacctatctttggagcagcaggtggtgga |
152 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| | || |||| | |||||| | |||||||||||||| ||||||||| |
|
|
| T |
24222409 |
gacacaaatggaaaccccatttttcctggtggcacattctatattatgccatcaatctttggagcagctggtggtgga |
24222332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University