View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_high_13 (Length: 266)
Name: NF1830_high_13
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 115 - 249
Target Start/End: Complemental strand, 42524816 - 42524682
Alignment:
| Q |
115 |
gatggggaagagattaatggagttcatgatgaggaagatatgatgaagaggatggtgtactataactattataatcagccactctatgttgttgaacgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42524816 |
gatggggaagagattaatggagttcatgatgaggaagatatgatgaagaggatgatgtactataactattataatcagccactctatgttgttgaacgaa |
42524717 |
T |
|
| Q |
215 |
tgccaccaccacctcaactctttagtgatgaaaat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42524716 |
tgccaccaccacctcaactctttagtgatgaaaat |
42524682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 40169895 - 40169955
Alignment:
| Q |
188 |
atcagccactctatgttgttgaacgaatgccaccaccacctcaactctttagtgatgaaaa |
248 |
Q |
| |
|
|||||| | ||||||| | |||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
40169895 |
atcagctagtctatgtggatgaaggaatcccacaaccacctcaactctttagtgatgaaaa |
40169955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University