View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_high_19 (Length: 235)
Name: NF1830_high_19
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 42099134 - 42099351
Alignment:
| Q |
5 |
tacttttacttttctattaaaaccaaattaatgattatcttcatcattgcactatttccttataatataccgcaaaatgaaacct--agagtattcataa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42099134 |
tacttttacttttctattaaaaccaaattaatgattatcttcatcattgcactatttccttataatataccgcaaaacgaaacctagagagtattcataa |
42099233 |
T |
 |
| Q |
103 |
gatattcagaatcagat--catatgagatagctaggtagcaatataaagagatcaatcgacttggaagctctgatattttgtggggaatgctgcctggtc |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099234 |
gatattcagaatcagattatatatgagatagctaggtagcaatataaagagatcaatcgtcttggaagctctgatattttgtggggaatgctgcctggtc |
42099333 |
T |
 |
| Q |
201 |
caaaaggagatcaatatatg |
220 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
42099334 |
c--aaggagatcaatatatg |
42099351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University