View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_low_12 (Length: 273)
Name: NF1830_low_12
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 6355116 - 6354893
Alignment:
| Q |
17 |
atgtatggatctaagtgaggggtgcacatgctcacttaaattttttaaattaatcttgtaccataagctatttaaaatttgacatccccatctatatact |
116 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6355116 |
atgtatggatctacgtgatgggtgcacatgctcacttaaattttttaaattaatcttgtaccataagctatttaaaatttgacatccccatctatatact |
6355017 |
T |
 |
| Q |
117 |
ttatatttgaacttctgtcttattagatttttaaaattgaaaattctactatctttttctatttaaaattgcttcttttcatacttctatgatctcttta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6355016 |
ttatatttgaacttctgtcttattagatttttaaaattgtaaattctactatctttttctatttaaaattgcttcttttcatacttctatgatctcttta |
6354917 |
T |
 |
| Q |
217 |
cttagactcttttaccaacattgt |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6354916 |
cttagactcttttaccaacattgt |
6354893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 121 - 214
Target Start/End: Complemental strand, 7461684 - 7461589
Alignment:
| Q |
121 |
atttgaacttctgtcttatt-agatttttaaaattgaaaattctact-atctttttctatttaaaattgcttcttttcatacttctatgatctctt |
214 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
7461684 |
atttgaacttctctcttaaagagatttttaaaattggaaattctactcatctttttctatttaaaattgcttctttttctacctctatgatctctt |
7461589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University