View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_low_14 (Length: 253)
Name: NF1830_low_14
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 51346251 - 51346027
Alignment:
| Q |
1 |
ataacaaaaaacaaacttcattttatgacttttgctttctcctaaatactccttccaatcatcattataaataaaaaataactttttaaatttattgaaa |
100 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51346251 |
ataaccaaaaacaaaattcattttatgacttttgctttctcctaaatactccttccaatcatcattataaataaaaaataactttttaaatttattgaaa |
51346152 |
T |
 |
| Q |
101 |
aacttatcaaaatactcccttgagagtacttgtattgcattgtagtattgttgaactttgtcacatgagcactttttcaattgcatttatgtaaaaagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
51346151 |
aacttatcaaaatactcccttgagagtacttgtattgca------------------ttgtcacataagcaccttttcaattgcatttatgtaaaaagtg |
51346070 |
T |
 |
| Q |
201 |
ccctccttttctttttcttctgtttcccttttaactctctgtg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51346069 |
ccctccttttctttttcttctgtttcccttttaactctctgtg |
51346027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 96
Target Start/End: Original strand, 27696626 - 27696657
Alignment:
| Q |
65 |
ttataaataaaaaataactttttaaatttatt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27696626 |
ttataaataaaaaataactttttaaatttatt |
27696657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University