View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_low_16 (Length: 249)
Name: NF1830_low_16
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_low_16 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 44261137 - 44260896
Alignment:
| Q |
8 |
tgagatgaaatggtgacagtagattcgccgattgctatgacgaataacgctcttttgtttctggaggtggcttttacaagaatgctttacgatgatggag |
107 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44261137 |
tgagaagaaatggtgacagtagattcaccgattgctatgacgaataacgctcttttgtttctggaggtggcttttacaagaatgctttacgatgacggag |
44261038 |
T |
|
| Q |
108 |
ccttggaacatgtttataatataattttatctacttttctttcatccttagagagcaattgctaacaatatactcctatctatagaacataaattatatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44261037 |
ccttggaacatgtttataatataattttatctacttttctttcatccttagagagcaattgctaacaatatactcctatctatagaacataaattatatg |
44260938 |
T |
|
| Q |
208 |
tgctgttgatggatcaaatgaatacctgacacaaacttaaat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44260937 |
tgctgttgatggatcaaatgaatacctgacacaaacttaaat |
44260896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 147 - 219
Target Start/End: Complemental strand, 44265151 - 44265085
Alignment:
| Q |
147 |
tttcatccttagagagcaattgctaacaatatactcctatctatagaacataaattatatgtgctgttgatgg |
219 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
44265151 |
tttcatccttagatagcaattgctaacaatata------tctgtagaacataaattatatgtgctgttgatgg |
44265085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University