View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_low_17 (Length: 248)
Name: NF1830_low_17
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 98 - 233
Target Start/End: Complemental strand, 40979289 - 40979153
Alignment:
| Q |
98 |
ttattcttcatcactaattagttttcgctagaatatgcattaattcatgnnnnnnnatcttctgtttatgaaattagtggaa-cattatgtcatctcaac |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40979289 |
ttattcttcatcactaattagttttcactagaatatgcattaattcatgtttttttatcttctgtttatgaaattagtggaaacattatgtcatctcaac |
40979190 |
T |
 |
| Q |
197 |
aacaacaacaagttcgtgaatggtccggaatcaatac |
233 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40979189 |
aacaacaacaagttcgtgagtggtccggaatcaatac |
40979153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 157 - 233
Target Start/End: Original strand, 34260308 - 34260381
Alignment:
| Q |
157 |
ttctgtttatgaaattagtggaacattatgtcatctcaacaacaacaacaagttcgtgaatggtccggaatcaatac |
233 |
Q |
| |
|
|||||||| || |||||||||||||| ||| ||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
34260308 |
ttctgtttgtggaattagtggaacatcatggcatct---caacaacaacaagttcgtgagtggtctggaatcaatac |
34260381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University