View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1830_low_19 (Length: 237)
Name: NF1830_low_19
Description: NF1830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1830_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 44260609 - 44260813
Alignment:
| Q |
18 |
tcttggtgatttgcctcctaattcatcatcaaaccaacttagtcaacatgttgatcttaatgacttgataaatcaactggatgatggtgttttgtgctgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
44260609 |
tcttggtgatttgcctcctaattcatcatcaaaccaacttagtcaacatgttaatcttaatgactgga---atcaactagatgatggtgttttgtgctgg |
44260705 |
T |
 |
| Q |
118 |
gattgtcaacctgatgagtttgtttggaaagatctttctttttaatctcaaaaagaagagggtggtgcaagttttgatggtttgaaactagcttcttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44260706 |
gattgtcaacctgatgagtttgtttggaaagatctttctttttaatctcaaaaagaagagggtggtgcaagttttgatggtttgaaactagcttcttgtt |
44260805 |
T |
 |
| Q |
218 |
tgtatttt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
44260806 |
tgtatttt |
44260813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 15978300 - 15978473
Alignment:
| Q |
17 |
atcttggtgatttgcctcctaattcatcatcaaaccaacttagtcaacatgttgatcttaatgacttgataaatcaactggatgatggtgttttgtgctg |
116 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||| ||||||||||||| || |||| | | || | | |||||||||| |||| |||||||||| |
|
|
| T |
15978300 |
atcttggtgatttgcatcctagttcatctacaaagcaacttagtcaacttgatgattctgacgattggttaaatcaactagatggtggtgttttgaatca |
15978399 |
T |
 |
| Q |
117 |
ggattgtcaacctgatgagtttgtttggaaagatctttctttttaatctcaaaaagaagagggtggtgcaagtt |
190 |
Q |
| |
|
|| | |||| ||| || ||||| | ||||||||||||||||||| |||||||| ||| |||| | |||||||| |
|
|
| T |
15978400 |
ggttagtcagcctcatcagtttttctggaaagatctttctttttcatctcaaagtgaaaagggcgatgcaagtt |
15978473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 169
Target Start/End: Original strand, 15978546 - 15978617
Alignment:
| Q |
98 |
atgatggtgttttgtgctgggattgtcaacctgatgagtttgtttggaaagatctttctttttaatctcaaa |
169 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
15978546 |
atgatggtgttttgaactgggctaatcaacctgatcagtttgcatggaaagatctttctttttcatctcaaa |
15978617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University